Handbook

Sequence Submission Protocol

Before sequences can be uploaded to BOLD, specimen data records must be uploaded to a BOLD project. Sequences can be uploaded directly to BOLD for loci that have been registered in the BOLD’s marker database. New marker loci can be registered by emailing support@boldsystems.org with a description of the loci and an example GenBank accession. Upon upload of sequences, BOLD automatically compares the COI sequences against known contaminants (Human, Mouse, Cow, Pig, Wolbachia, etc.) and flags the record if there is a reasonable match. The upload event (person, activity, and timestamp) and the institution supporting the sequence editing are recorded in the audit trail to ensure proper attribution.

Sequence Uploads

1. Assemble FASTA formatted sequences
   • The sequence submission should consist of aligned sequences in FASTA format referenced by BOLD Process IDs or Sample IDs
     • To upload with Process IDs, obtain the Process IDs by clicking on Data Spreadsheets under the Downloads menu on the left side of a Project Console. Download the Progress Report to get the Process IDs that are assigned to each Sample ID.
     • The FASTA header line must conform to the following format: it should begin with a ‘>’, followed by the Process ID, followed by either a pipe (‘|’), an underscore (‘_’) or a space (‘ ’), followed by any other information that should be added. There can be no spaces before the end of the Process ID:
       • >"Process ID"|"Other Info"

         AGTCGACTAGCATCGATCGATCGTAGCTA...

     • To upload with Sample IDs, the FASTA header line must conform to the following format: it should begin with a ‘>’, followed by the Sample ID, followed by a pipe (‘|’), followed by any other information that should be added. For Sample ID uploads, an underscore (‘_’) or a space (‘ ’) is not allowed to divide the Sample ID from additional data in the header line.
       • >"Sample ID"|"Other Info"

         AGTCGACTAGCATCGATCGATCGTAGCTA...

2. Submit Sequences to BOLD
   1. Login to BOLD and click on Sequences under the Data Uploads menu in the User Console. This option is available to project managers and project users with editing sequence access.
   2. In the form, paste in the FASTA formatted sequences to submit to the project, BOLD will accept up to 1000 sequences in one upload, select the ID type, markers, and the run site for attribution. Only one type of sequence can be uploaded at a time. A brief description can also be included, if desired.
   3. Click on Submit. Do not close the pop-up window until the successful upload message is displayed. Sequences will be immediately uploaded to the records.

Sequence uploading form.

Field definitions for sequence upload window

Select ID:	Either Process ID or Sample ID may be used for upload.
Marker:	The marker (loci) of the sequences.
Run Site:	The lab that assembled and validated the sequences.
Paste sequences in FASTA format:	Example of Process ID upload: >TZBNA001-05|species name|region CTGCAGGANCAAAAAATGAAGTATTTAAATTTCGATCTGTTAATAATAACTAGCTACGCATGACA ATGCTCAGCAAAGCTGTAATTCCTACAGCTCAAACGAAAAGGGGTAGTTGATAAAATTAATTGCT CCTAAAATAGAAGAA >TZBNA002-05 CAGCTAATACGGGTAAAGATAATAATAATAAAAAAGCTGTAATTCCTACGATCGTACGCCAAAAAA TATATTATTTAAGCGTATATTAATAATAGTTGATGGCTAGGTATAATAAAATTGAAAAAATAGCTAAA TCTACAGAACTACCCCCATGGGCGATATTAGA >TZBNA012-05 AAAATAGCTAAATCAACTGAGCTTCCTCCATGAGCAATATTAGATGATGCTTCGATCTACAGC TCCATTTTCTACCACTCTTCTTGAAATTAAAAGAGTAATAGAAG

After sequences are uploaded, they are immediately viewable and downloadable on BOLD. Sequences are auto-checked during upload for stop codons and common contaminates. These are then recorded in the Project Console and flagged in the Record List.

Sequence Replacements and Deletions

• To edit a sequence on BOLD, navigate to the Sequence Page for the sample and select Edit Sequence. A text box will appear where changes can be made to the sequence.
• To replace a sequence on BOLD, simply upload a new sequence with the same Process ID or Sample ID.
• To delete a sequence on BOLD, use the "Delete" button that appears on the Sequence Page.

For any questions or issues regarding sequence submissions, please contact the BOLD Support Team through support@boldsystems.org

Back to Top